...
Test Samples: rhizosphere extractions
The first PCR was conducted in 8 μL volumes containing 50 nM of each primer, 3.0 mM of MgCl2, 200 μM each dNTP (Phenix Research, Candler, NC), 0.01 U/μL Phusion HotStart II DNA Polymerase (Life Technologies), 1× HF Phusion Buffer (Life Technologies), 6% glycerol, and 1 μL of diluted template DNA. PCR cycling conditions were 95 °C for 2 min followed by 30 cycles of 95 °C for 1 min, 54 °C for 1 min, and 72 °C for 1 min with a final extension at 72 °C for 10 mi
...
Temp Gradient Test to min. non specific amplification and max. product
Normalize eDNA to 10 ng/ul.
Add 11 ul Master mix to each well of a new plate:
Reagent | ul/rxnReagent | rxns | 3ul needed |
|---|---|---|---|
5X KAPA HiFi HotStart PCR Buffer | 3 | 0.45 | 135 |
10M dNTPs | 0.45 | 45 | 20.3 |
Kapa HiFi HotStart DNA Pol | 7.250.3 | 45 | 13.5 |
HPLC H2O | 7.25 | 45 | 326.2 |
Total Volume | 11 | 45 | 495 |
Add 2 ul appropriate 1.25 2 uM paired primers Molecular IDentifier (MID) Plate:______________
Use same template across all wells except row A. Add 2 ul template:
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
A | Blank | Blank | Blank | Blank |
|
|
|
|
|
|
|
|
B | 64.4C | 64.4C | 64.4C | 64.4C |
|
|
|
|
|
|
|
|
C | 63.2C | 63.2C | 63.2C | 63.2C |
|
|
|
|
|
|
|
|
D | 61C | 61C | 61C | 61C |
|
|
|
|
|
|
|
|
E | 58.3C | 58.3C | 58.3C | 58.3C |
|
|
|
|
|
|
|
|
F | 56.2C | 56.2C | 56.2C | 56.2C |
|
|
|
|
|
|
|
|
G | 54.7C | 54.7C | 54.7C | 54.7C |
|
|
|
|
|
|
|
|
H | 54C | 54C | 54C | 54C |
|
|
|
|
|
|
|
|
Seal with bubble seals, spin, and run on thermocycler
Run on Thermocycler Program Am18S1Gr:
...
ul/rxn | Reagent | # of rxns | ul needed |
|---|---|---|---|
3 | 5X Kapa HiFi Buffer | 6025 | 21075 |
0.45 | 10M dNTPs | 6025 | 3111.52 |
0.3 | Kapa HiFi HotStart DNA Pol | 602521 | 7.5 |
0.5 ul | 10 uM F and R FlowCell Primers | 602535 | 12.5 |
0.75 | HPLC H2O | 6025 | 5218.58 |
5 | Total Volume | 6025 | 350125 |
FlowCell Primers
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC
CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGG
...