...
Test Samples: rhizosphere extractions
The first PCR was conducted in 8 μL volumes containing 50 nM of each primer, 3.0 mM of MgCl2, 200 μM each dNTP (Phenix Research, Candler, NC), 0.01 U/μL Phusion HotStart II DNA Polymerase (Life Technologies), 1× HF Phusion Buffer (Life Technologies), 6% glycerol, and 1 μL of diluted template DNA. PCR cycling conditions were 95 °C for 2 min followed by 30 cycles of 95 °C for 1 min, 54 °C for 1 min, and 72 °C for 1 min with a final extension at 72 °C for 10 mi
Indexing PCR cycling conditions were 95 °C for 2 min followed by 10 cycles of 95°C for 30s, 62°C for 30s, and 68°C for 1min and 30s.
Normalize eDNA to 10 ng/ul
Add 11 ul Master mix to each well of a new plate:
ul/rxn | Reagent |
|---|---|
3 | 5X KAPA HiFi HotStart PCR Buffer |
0.45 | 10M dNTPs |
0.3 | Kapa HiFi HotStart DNA Pol |
7.25 | HPLC H2O |
7 | Total Volume |
Add 2 ul appropriate 1.25 uM paired primers Molecular IDentifier (MID) Plate:______________
Run on Thermocycler Program Am18S1Gr:
Temp C | Cycles | Time |
|---|---|---|
95 | 1X | 3:00 |
95 | 20X | 1:00 |
54 (Gradient) | 20X | 1:00 |
72 | 20X | 1:00 |
72 | 1X | 10:00 |
4 | 1X | 0:00 |
Pool duplicates together.
Purify samples using modified manual AxyPrep MagBead PCR Clean-Up :
Equilibrate Beads to room Temperature
Pool Duplicate PCR reactions (Transfer 15 ul of one replicate to the other)
Add 24 ul of MagBeads to each well; Pipette mix up and down 10 times.
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 30 ul H2O; pipette mix 10+ times. Incubate 2 minutes at RT.
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Prepare next MasterMix while sample plate is on the magnet plate.
Add 5 ul FlowCell MasterMix to new plate:
ul/rxn | Reagent | # of rxns | ul needed |
|---|---|---|---|
3 | 5X Kapa HiFi Buffer | 60 | 210 |
0.45 | 10M dNTPs | 60 | 31.5 |
0.3 | Kapa HiFi HotStart DNA Pol | 60 | 21 |
0.5 ul | 10 uM F and R FlowCell Primers | 60 | 35 |
0.75 | HPLC H2O | 60 | 52.5 |
5 | Total Volume | 60 | 350 |
FlowCell Primers
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC
CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGG
Transfer 10 ul from plate on magnet plate to new plate.
Run on Thermocycler Program Am18S2:
Temp C | Cycles | Time |
|---|---|---|
95* | 1X | 3:00* |
95 | 20X | 0:30 |
55 | 20X | 1:00 |
72 | 20X | 1:30 |
72 | 1X | 5:00 |
4 | 1X | 0:00 |
Equilibrate Beads to room Temperature
Add 15 ul H2O to each sample
Add 24 ul (0.8 x 30 ul) of MagBeads to each well; Pipette mix up and down 10 times
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well.
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 40 ul TE; pipette mix 10 times
Incubate at RT for 2 minutes
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Transfer 40 ul to a clean PCR plate.