...
Synthgene Structure: 5'-LocusPrimer Nonsense InverseLocusPrimer-3'
ITS Synthgene:
CTTGGTCATTTAGAGGAAGTAATGCCACAGATACGTACCGCTCATAACGCGAACCGAAGCGCAGTAGAAGTACTCCGTATCCTACCTCGGTCGTGGTTTAGGCTATCGACATCTTGCATGGGCTTCCCTAGTGAACTCTTGGGATGTGCATCGATGAAGAACGCAGC
Alignment of primers and synthetic amplicon control molecules (synthgenes): Synthgene_detective.pdf (also on OneDrive).
16S Synthgene:
GTGCCAGCAGCCGCGGTAAGCCACAGATACGTACCGCTCATAACGCGAACCGAAGCGCAGTAGAAGTACTCCGTATCCTACCTCGGTCGTGGTTTAGGCTATCGACATCTTGCATGGGCTTCCCTAGTGAACTCTTGGGATGTATTAGATACCCTAGTAGTCC
...
Add 6 ul appropriate 0.25 uM paired primers Molecular IDentifier (MID) Plate:______________
16S Primer Base
515F (5’-GTGYCAGCMGCCGC GGTAA-3’) (Parada et al. 2016)
806R (5’-GGACTACNVGGGTWTCTAAT-3’) (Apprill et al. 2015)
ITS Primer Base
ITS1F (5'-CTTGGTCATTTAGAGGAAGTAA-3')(Gardes et al 1993)
ITS2 (3'-CGTAGCTACTTCTTGCGTCG-5') (White et al 1990)
Primer structure
5'-
PARTIAL_ILLUMINA_FLOWCELL_SEQbarcodeGTGYCAGCMGCCGCGGTAA-3'5'-
PARTIAL_ILLUMINA_FLOWCELL_SEQbarcodeGGACTACHVGGGTWTCTAAT-3'5'-
PARTIAL_ILLUMINA_FLOWCELL_SEQbarcodeCTTGGTCATTTAGAGGAAGTAA-3'5'-
PARTIAL_ILLUMINA_FLOWCELL_SEQbarcodeGCTGCGTTCTTCATCGATGC-3'
Actual Sequences: https://microcollaborative.atlassian.netnull/pages/createpage.action?spaceKey=MICLAB&title=Information%20on%20oligos&linkCreation=true&fromPageId=351141889 Information on oligos
Each 515F/806R and ITS1F/ITS2 were arrayed to create all 9216 possible MID pairings. The first MID array was a stamp of both plates (A1 in A1 for both plates) and was labeled 16S0A1 or ITS0A1. The second plate was a stamp of the reverse plate but the forward plate was rotated so that B1 went in A1, C1 in B1, D1 in C1, . . . , H12 in G12 and A1 in H12. This second plate was labeled 16S0B1 or ITS0B1 referring to the original position of the forward oligo plate MID that was located in A1 of the arrayed plate. This schema was continued around until 16S0H12 and ITS0H12 for 96 total MID plates for each locus.
...
ul/rxn | Reagent | # of rxns | ul needed |
|---|---|---|---|
3 | 5X Kapa HiFi Buffer | 60 | 210 |
0.45 | 10M dNTPs | 60 | 31.5 |
0.3 | Kapa HiFi HotStart DNA Pol | 60 | 21 |
0.5 ul | 10 uM F and R FlowCell Primers | 60 | 35 |
0.75 | HPLC H2O | 60 | 52.5 |
5 | Total Volume | 60 | 350 |
FlowCell Primers
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC
CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGG
...
Temp C | Cycles | Time |
|---|---|---|
95* | 1X | 3:00* |
98 | 19X | 0:30 |
55* | 19X | 0:30 |
72 | 19X | 0:30 |
72 | 1X | 5:00 |
4 | 1X | 0:00 |
Purify samples using GSAF’s second modified MagBead protocol:
Equilibrate Beads to room Temperature
...
Normalize PCR’s via absorbance concentrations. Gregg Randolph What concentration did you normalize to? Or has this not been finalized yet?
Pool normalized PCRs
Check Pool’s molar concentration via qPCR:
Dilute Pool 1:1000
Include NTC and Standards (20 pm, 2 pm, 0.2, 0.02pm, 0.002pm, 0.0002pm)
...