Paper detailing target and base primers
Fwd Primer Base (WANDA): CAGCCGCGGTAATTCCAGCT*
Rev Primer Base (AML2): GAACCCAAACACTTTGGTTTCC
200 sample multiplex required. Sticking to full columns for ease of handling, we will need 16 forward and 16 reverse primers for 256 possible combinations.
Design and sequences of 2-step sequencing primers.
Test Samples: rhizosphere extractions
Temp Gradient Test to min. non specific amplification and max. product
Normalize eDNA to 10 ng/ul.
Add 11 ul Master mix to each well of a new plate:
Reagent | ul/rxn | rxns | ul needed |
|---|---|---|---|
5X KAPA HiFi HotStart PCR Buffer | 3 | 45 | 135 |
10M dNTPs | 0.45 | 45 | 20.3 |
Kapa HiFi HotStart DNA Pol | 0.3 | 45 | 13.5 |
HPLC H2O | 7.25 | 45 | 326.2 |
Total Volume | 11 | 45 | 495 |
Add 2 ul appropriate 1 uM paired primers Molecular IDentifier (MID) Plate:______________
Use same template across all wells except row A. Add 2 ul template:
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
A | Blank | Blank | Blank | Blank |
|
|
|
|
|
|
|
|
B | 64.4C | 64.4C | 64.4C | 64.4C |
|
|
|
|
|
|
|
|
C | 63.2C | 63.2C | 63.2C | 63.2C |
|
|
|
|
|
|
|
|
D | 61C | 61C | 61C | 61C |
|
|
|
|
|
|
|
|
E | 58.3C | 58.3C | 58.3C | 58.3C |
|
|
|
|
|
|
|
|
F | 56.2C | 56.2C | 56.2C | 56.2C |
|
|
|
|
|
|
|
|
G | 54.7C | 54.7C | 54.7C | 54.7C |
|
|
|
|
|
|
|
|
H | 54C | 54C | 54C | 54C |
|
|
|
|
|
|
|
|
Seal with bubble seals, spin, and run on thermocycler
Run on Thermocycler Program Am18S1Gr:
Temp C | Cycles | Time |
|---|---|---|
95 | 1X | 3:00 |
95 | 20X | 1:00 |
54 (Gradient) | 20X | 1:00 |
72 | 20X | 1:00 |
72 | 1X | 10:00 |
4 | 1X | 0:00 |
Pool duplicates together.
Purify samples using modified manual AxyPrep MagBead PCR Clean-Up :
Equilibrate Beads to room Temperature
Pool Duplicate PCR reactions (Transfer 15 ul of one replicate to the other)
Add 24 ul of MagBeads to each well; Pipette mix up and down 10 times.
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 30 ul H2O; pipette mix 10+ times. Incubate 2 minutes at RT.
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Prepare next MasterMix while sample plate is on the magnet plate.
Add 5 ul FlowCell MasterMix to new plate:
ul/rxn | Reagent | # of rxns | ul needed |
|---|---|---|---|
3 | 5X Kapa HiFi Buffer | 25 | 75 |
0.45 | 10M dNTPs | 25 | 11.2 |
0.3 | Kapa HiFi HotStart DNA Pol | 25 | 7.5 |
0.5 ul | 10 uM F and R FlowCell Primers | 25 | 12.5 |
0.75 | HPLC H2O | 25 | 18.8 |
5 | Total Volume | 25 | 125 |
FlowCell Primers
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC
CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGG
Transfer 10 ul from plate on magnet plate to new plate.
Run on Thermocycler Program Am18S2:
Temp C | Cycles | Time |
|---|---|---|
95* | 1X | 3:00* |
95 | 20X | 0:30 |
55 | 20X | 1:00 |
72 | 20X | 1:30 |
72 | 1X | 5:00 |
4 | 1X | 0:00 |
Equilibrate Beads to room Temperature
Add 15 ul H2O to each sample
Add 24 ul (0.8 x 30 ul) of MagBeads to each well; Pipette mix up and down 10 times
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well.
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 40 ul TE; pipette mix 10 times
Incubate at RT for 2 minutes
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Transfer 40 ul to a clean PCR plate.