CO1Lark PCR Test

This experiment is to test the latest extraction method, QIAamp Fast DNA Stool Mini Kit using the larger volume protocol. Primer Source Paper

Primer bases:

LCO1490F (forward): GGTCAACAAATCATAAAGATATTGG

COI-CFMRa (reverse): GGWACTAATCAATTTCCAAATCC

95 °C for 60 s, 45 °C for 90 s, 72 °C for 90 s; 28 cycles of: 94 °C for 60 s, 50 °C for 90 s, 72 °C for 60 s

PCR MasterMix

ul/rxn	Reagent	# of rxns	ul needed

ul/rxn	Reagent	# of rxns	ul needed
3	5X Kapa HiFi Buffer	50	150
0.45	10M dNTPs	50	22.5
0.3	Kapa HiFi HotStart DNA Pol	50	15
7.25	HPLC H2O	50	362.5
11	Total Volume	50	550

Add 11 ul to each well of a hard shell, full skirt plate. Add 2 uL of 0.5 uM primers and 2uL of template to each well.
Primers:

Run CO1Lark plates on thermocycler program CO1Lark:

Step	Temp C	Cycles	Time

Step	Temp C	Cycles	Time
Denature	95	1X	10:00
Denature	94	35X	1:00
Annealing** (Row C)	50	35X	1:30
Extension/Elongation	72	35X	1:00
Final Extension	72	1X	10:00
Hold	4	1X	0:00

Positive Control Butterfly (D1):

Extraction Blank(A2):

Typical Amplification (42/D2):

Worst Amplification (43/E2):

Best Amplification (46/H2):