TRNL herbivorous diet study (TRNL1)
Data were transferred to the GTL on 12-02-2021. They were relayed to the clients on 12-07-2021
Pools were sent to UC Genomics Core, waiting for repair this week of sequencer. Received tape station QC on 11-16-2021 and the GTL and University of Colorado approved for sequencing.
Sample ID | PF Clusters | Yield (Mbases) | % PF Clusters | % >= Q30 | Mean Quality Score |
TRNL1_T_16S_Pool | 503,270,296 | 262,707 | 78.84 | 90.31 | 35.21 |
TRNL1_T_16S_Pool | 501,795,512 | 261,937 | 78.61 | 90.06 | 35.16 |
Review of Tape Station QC from the University of Colorado was used to okay sequencing there.
Initial report from LIMS was converted with this r-script to the format for our bioinformatics pipeline to this demux key.
Design Info
Paper specifying target primer sequence
Forward Base Primer Sequence (trnl g) : GGGCAATCCTGAGCCAA
Reverse Base Primer Sequence (trnl h) : CCATTGAGTCTCTGCACCTATC
~500 Fecal Samples
<700 plant samples
It is likely we will be dealing with fewer plant samples than 700. 32 forward and 32 reverse primers will provide 1024 possible combinations or 10.66 plates. 40 by 40 will complicate pairing programing since 96 is not divided evenly by 40.
Design and sequences of 1-step sequencing primers.
Possibly adding more amplicons for parasites. This paper gives us some possible loci to consider.
Primer Dilution and arraying to 0.75 uM each
Primers arrived 9-14-2021 as 90 ul of TE at 100 uM. Add 710 ul TE to reduce Stock Concentration to 11.25 uM. Add 130 ul TE to 24 hard shell PCR plates. Run TRNL_Primer_Prep_Fully_Adjustable to array primers.
Arraying started at 9-15-21 at 11:04AM and finished at 5PM.