1 -step Library preparation protocol for 16s or ITS
Aliquot 30 ul of full concentration DNA extract
Add 6 ul of control oligo pool to environmental DNA aliquot (16S and ITS coligo 0.01 pg/ul each AND 16S SG_GR and ITS SG_GR 0.03 pg/ul each
16S Coligo: 5'-GTGCCAGCAGCCGCGGTAA AACAACAACAACC ATTAGATACCCTAGTAGTCC-3'
Coligo Structure: 5'-LocusPrimer Barcode InverseLocusPrimerR -3'
ITS Coligo: 5'-CTTGGTCATTTAGAGGAAGTAAT AACAACAACAACC CGTAGCTACTTCTTGCGTCG-3'
Coligo creation and quality control
Synthgene Structure: 5'-LocusPrimer Nonsense InverseLocusPrimer-3'
ITS Synthgene:
CTTGGTCATTTAGAGGAAGTAATGCCACAGATACGTACCGCTCATAACGCGAACCGAAGCGCAGTAGAAGTACTCCGTATCCTACCTCGGTCGTGGTTTAGGCTATCGACATCTTGCATGGGCTTCCCTAGTGAACTCTTGGGATGTGCATCGATGAAGAACGCAGC
Alignment of primers and synthetic amplicon control molecules (synthgenes): Synthgene_detective.pdf (also on OneDrive).
16S Synthgene:
GTGCCAGCAGCCGCGGTAAGCCACAGATACGTACCGCTCATAACGCGAACCGAAGCGCAGTAGAAGTACTCCGTATCCTACCTCGGTCGTGGTTTAGGCTATCGACATCTTGCATGGGCTTCCCTAGTGAACTCTTGGGATGTATTAGATACCCTAGTAGTCC
https://microcollaborative.atlassian.net/browse/FS2017DNA-13
Normalize eDNA to 10 ng/ul unless the extracted sample starts lower than this. Samples lower than 10 ng/ul enter the PCR reactions at their starting concentration. Samples are quantified via absorbance. These are used in the Hamilton Nimbus program “Normalization_Tracking” to transfer sample and TE into a new plate in a combined volume of 20 ul and concentration of 10 ng/ul. The program simply transfers 20 ul from one plate to the other for samples under 10 ng/ul.
Add 7 ul Master mix to each well of a new plate prepared as per the Amplicon MM protocol:
ul/rxn | Reagent |
|---|---|
3 | 5X KAPA HiFi HotStart PCR Buffer |
0.45 | 10M dNTPs |
0.3 | Kapa HiFi HotStart DNA Pol |
7.25 | HPLC H2O |
11 | Total Volume |
Add 2 ul appropriate 0.75 uM paired primers Molecular IDentifier (MID) Plate:______________
16S Primer Base
515F (5’-GTGYCAGCMGCCGC GGTAA-3’) (Parada et al. 2016)
806R (5’-GGACTACNVGGGTWTCTAAT-3’) (Apprill et al. 2015)
Together amplify a 292 bp region in E. coli
ITS Primer Base
ITS1F (5'-CTTGGTCATTTAGAGGAAGTAA-3')(Gardes et al 1993)
ITS2 (3'-CGTAGCTACTTCTTGCGTCG-5') (White et al 1990)
Together amplify a 256 bp region in Candida albacans
Primer structure
5'-
FULL_ILLUMINA_FLOWCELL_SEQbarcodeGTGYCAGCMGCCGCGGTAA-3'5'-
FULL_ILLUMINA_FLOWCELL_SEQbarcodeGGACTACHVGGGTWTCTAAT-3'5'-
FULL_ILLUMINA_FLOWCELL_SEQbarcodeCTTGGTCATTTAGAGGAAGTAA-3'5'-
FULL_ILLUMINA_FLOWCELL_SEQbarcodeGCTGCGTTCTTCATCGATGC-3'
Actual Sequences: https://microcollaborative.atlassian.net/wiki/spaces/MICLAB/pages/137330762
Each 515F/806R and ITS1F/ITS2 were arrayed to create all 9216 possible MID pairings. The first MID array was a stamp of both plates (A1 in A1 for both plates) and was labeled long16S0A1 or longITS0A1. The second plate was a stamp of the reverse plate but the forward plate was rotated so that B1 went in A1, C1 in B1, D1 in C1, . . . , H12 in G12 and A1 in H12. This second plate was labeled 16S0B1 or ITS0B1 referring to the original position of the forward oligo plate MID that was located in A1 of the arrayed plate. This schema was continued around until long16S0H12 and longITS0H12 for 96 total MID plates for each locus.
Add 2 ul of modified eDNA aliquot to each well
Run on Thermocycler Program GSAF35:
Temp C | Cycles | Time |
|---|---|---|
95* | 1X | 3:00* |
98 | 35X | 0:30 |
62 | 35X | 0:30 |
72 | 35X | 0:30 |
72 | 1X | 5:00 |
4 | 1X | 0:00 |
Pool duplicates together.
Purify samples using modified manual AxyPrep MagBead PCR Clean-Up (GSAF uses AmpPure XP):
AmpPure XP PCR cleanup and AxyPrep MagBead have the exact same stock protocol!
Equilibrate Beads to room Temperature
Pool Duplicate PCR reactions (Transfer 15 ul of one replicate to the other)
Add 24 ul of MagBeads to each well; Pipette mix up and down 10 times.
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 40 ul TE; pipette mix 10+ times. Incubate 2 minutes at RT.
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Transfer 40 ul to new plate.
Quantify via absorbance resulting plate.
Use Nimbus to normalize to 10ng/ul or less.
Pool resulting products.
Check Pool’s molar concentration via qPCR:
Dilute Pool 1:1000
Include NTC and Standards (20 pm, 2 pm, 0.2, 0.02pm, 0.002pm, 0.0002pm)
ul/rxn | Reagent |
|---|---|
10 ul | KAPA SYBR FAST qPCR MM (2X) |
2 ul | Primer Premix (10X) |
4 ul | Ultra Pure Water |
16 ul | Total Volume |
qPCR
Temp C | Cycles | Time |
|---|---|---|
94 | 1X | 0:01 |
95 | 1X | 5:00 |
95 | 32X | 0:30 |
60 | 1:00 |
If necessary, concentrate via Vacuum Concentrator (SpeedVac DNA130)
Complete Libraries are sent to the Genomic Sequencing and Analysis Facility at the University of Texas to be run on their NovaSeq 6000 using paired end 2x250 chemistry. It will be treated like a low diversity library with a likely 10% PhiX spike in.
Small format libraries may be run on our iSeq100 with a 10% PhiX spike-in after dilution to 60 pM.
Hi Gregg, Thanks for putting these methods pages together. I’m curious as to why we normalize DNA before PCR. The source of this DNA template could be bacteria, archaea, fungi, plant, animal etc. Since we are using the resources to check concentrations, would it make more sense to do this after PCR, so that info could be used for normalization as well? Curious to hear anyones thoughts.