Curran Sage Grouse Project
- Gregg Randolph
Expect ~600 samples
DNA Extraction:
DNA extraction from feces was performed with the DNA Stool Mini kit (Qiagen) according to the vendor's protocol with modifications as specified below. Digestion was conducted overnight at 56°C in a shaker 550 rpm. After two washing steps with the provided buffer, the DNA was sequentially recovered in 2 × 75 μl buffer AE and stored at −20°C.
https://doi.org/10.1002/ece3.3951
Insect Diet Profiling:
Add some butterfly DNA as a positive control
Primer bases:
LCO1490F (forward): GGTCAACAAATCATAAAGATATTGG
COI-CFMRa (reverse): GGWACTAATCAATTTCCAAATCC
95 °C for 60 s, 45 °C for 90 s, 72 °C for 90 s; 28 cycles of: 94 °C for 60 s, 50 °C for 90 s, 72 °C for 60 s
PCR MasterMix
ul/rxn | Reagent | # of rxns | ul needed |
|---|
ul/rxn | Reagent | # of rxns | ul needed |
|---|---|---|---|
3 | 5X Kapa HiFi Buffer | 50 | 150 |
0.45 | 10M dNTPs | 50 | 22.5 |
0.3 | Kapa HiFi HotStart DNA Pol | 50 | 15 |
7.25 | HPLC H2O | 50 | 362.5 |
11 | Total Volume | 50 | 550 |
Add 11 ul to each well of a hard shell, full skirt plate. Add 2 uL of 0.5 uM primers and 2uL of template to each well.
Primers:
Run CO1Lark plates on thermocycler program CO1Lark:
Step | Temp C | Cycles | Time |
|---|---|---|---|
Denature | 95 | 1X | 10:00 |
Denature | 94 | 35X | 1:00 |
Annealing** (Row C) | 50 | 35X | 1:30 |
Extension/Elongation | 72 | 35X | 1:00 |
Final Extension | 72 | 1X | 10:00 |
Hold | 4 | 1X | 0:00 |
Plant Diet Profiling:
TRNL
Paper specifying target primer sequence
Forward Base Primer Sequence (trnl g) : GGGCAATCCTGAGCCAA
Reverse Base Primer Sequence (trnl h) : CCATTGAGTCTCTGCACCTATC
or fullITS
Primer bases:
ITS-p5 (forward): CCTTATCAYTTAGAGGAAGGAG
ITS-p4 (reverse): CCGCTTAKTGATATGCTTAAA
94 °C for 4 min, followed by 34 cycles of 30 s at 94 °C, 40 s at 55 °C (or 58 °C) and 1 min at 72 °C, with a final step of 10 min at 72 °C.
Add some Populous DNA as a positive control