Curran Sage Grouse Project

Expect ~600 samples

DNA Extraction:

DNA extraction from feces was performed with the DNA Stool Mini kit (Qiagen) according to the vendor's protocol with modifications as specified below. Digestion was conducted overnight at 56°C in a shaker 550 rpm. After two washing steps with the provided buffer, the DNA was sequentially recovered in 2 × 75 μl buffer AE and stored at −20°C.

https://doi.org/10.1002/ece3.3951

Insect Diet Profiling:

Primer Source Paper

Add some butterfly DNA as a positive control

Primer bases:

LCO1490F (forward): GGTCAACAAATCATAAAGATATTGG

COI-CFMRa (reverse): GGWACTAATCAATTTCCAAATCC

95 °C for 60 s, 45 °C for 90 s, 72 °C for 90 s; 28 cycles of: 94 °C for 60 s, 50 °C for 90 s, 72 °C for 60 s

PCR MasterMix

ul/rxn	Reagent	# of rxns	ul needed

ul/rxn	Reagent	# of rxns	ul needed

ul/rxn	Reagent	# of rxns	ul needed

ul/rxn	Reagent	# of rxns	ul needed
3	5X Kapa HiFi Buffer	50	150
0.45	10M dNTPs	50	22.5
0.3	Kapa HiFi HotStart DNA Pol	50	15
7.25	HPLC H2O	50	362.5
11	Total Volume	50	550

Add 11 ul to each well of a hard shell, full skirt plate. Add 2 uL of 0.5 uM primers and 2uL of template to each well.
Primers:

Run CO1Lark plates on thermocycler program CO1Lark:

Step	Temp C	Cycles	Time

Step	Temp C	Cycles	Time
Denature	95	1X	10:00
Denature	94	35X	1:00
Annealing** (Row C)	50	35X	1:30
Extension/Elongation	72	35X	1:00
Final Extension	72	1X	10:00
Hold	4	1X	0:00

Plant Diet Profiling:

TRNL

Paper specifying target primer sequence

Forward Base Primer Sequence (trnl g) : GGGCAATCCTGAGCCAA

Reverse Base Primer Sequence (trnl h) : CCATTGAGTCTCTGCACCTATC

or fullITS

Primer Source Paper

Primer bases:

ITS-p5 (forward): CCTTATCAYTTAGAGGAAGGAG

ITS-p4 (reverse): CCGCTTAKTGATATGCTTAAA

94 °C for 4 min, followed by 34 cycles of 30 s at 94 °C, 40 s at 55 °C (or 58 °C) and 1 min at 72 °C, with a final step of 10 min at 72 °C.

Add some Populous DNA as a positive control