DIY RNA-seq testing
bulk RNA-seq is a need expressed in our survey
This is a possible cheap DIY prep
Costs:
Primer Investments: $2800
Reference Articles:
https://dx.doi.org/10.17504/protocols.io.q26g7yrr3gwz/v1
https://dx.doi.org/10.17504/protocols.io.bwu5pey6
Oligos needed:
3iLL - 30TV : ACGTGTGCTCTTCCGATCTAATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTV
5iLL : CTACACGACGCTCTTCCGATCT
/5Me-isodC//iisodG//iMe-isodC/CCATGCGGCTACACGACGCTCTTCCGATCTNNMWWMWHrGrGrG
/5Me-isodC//iisodG//iMe-isodC/CCATGCGGCTACACGACGCTCTTCCGATCTNNGCWTCHMWrGrGrG
/5Me-isodC//iisodG//iMe-isodC/CCATGCGGCTACACGACGCTCTTCCGATCTNNTGCMWrGrGrG
/5Me-isodC//iisodG//iMe-isodC/CCATGCGGCTACACGACGCTCTTCCGATCTNNMWrGrGrG
Can use the same indexing primers from 2-step amplicon and WGS
Costs: $2800? from IDT. I have other feelers out
RNA Fragmentation and RT Primer Annealing
Create MM:
Reagent | V/rxn | rxns | V needed |
|---|---|---|---|
dNTPs (10mM) | 0.55 |
|
|
0.1 M DTT | 1.1 |
|
|
5x FS Buffer | 2.2 |
|
|
3iLL-30TV (10uM) | 0.55 |
|
|
Total | 8.8 |
|
|
Add 4 ul to each well
Add 5 ul RNA (5-100 ng/ul) to each well.
Incubate 95C for 2.5 min, then place on ice for 2 minutes
First strand synthesis
Make MM:
Reagent | V/rxn | rxns | V needed |
|---|---|---|---|
TS oligo pool (10uM) | 0.55 |
|
|
SmartScribeRT (100U/ul) | 0.55 |
|
|
Add 1 ul MM to each rxn. Mix, seal, spin.
Temp | Time |
|---|---|
42C | 0:00 |
42C | 1:00:00 |
70C | 0:15:00 |
4C | 0:00 |
cDNA Amplification
Prepare MM:
Reagent | 1x ul | Rxns | ul Needed |
|---|---|---|---|
H2O | 9.35 | 20 | 60 |
5X PCR buffer | 5.5 | 20 | 100 |
dNTPs | 0.33 | 20 | 6 |
10uM 5iLL | 0.5 |
|
|
10uM 3iLL - 30TV | 0.5 |
|
|
KAPA HiFi Hot Start Pol | 0.22 | 20 | 4 |
Total | 15 | 20 | 170 |
Add 15 ul to to each well
Run on Thermocycler:
Temp | Time | Cycles |
|---|---|---|
98 | 3:00 | 1x |
98 | 0:30 | 15x |
98 | 0:30 | |
63 | 0:30 | |
72 | 1:00 | |
72 | 5:00 |
|
8 | hold | 1x |
Bead Cleanup
Remove beads from cold room and let sit at RT for 30mins. Mix by inversion, light shaking before use.
Add 25 ul H2O and 45 ul Beads with Pipette Mix 10x using Integra pipette
Incubate RT 15 minutes
Incubate on magnet 5 minutes
Remove supernatant ~90 ul
Wash with 80% EtOH twice with 30s incubations
Remove any remaining EtOH
Resuspend in 15 ul H20 with mixing 10x
Incubate 5 minutes RT
Incubate 2 minutes on magnet
Transfer 10 ul to new wells (with MM on ice if proceeding)
Save both in freezer or proceed
Indexing PCR
Add 7.5 ul MM to each well:
ul/rxn | Reagent | # of rxns | ul needed |
|---|---|---|---|
4.4 | 5X Kapa HiFi Buffer | 10 | 30 |
0.66 | 10M dNTPs | 10 | 4.5 |
0.44 | Kapa HiFi DNA Pol | 10 | 3 |
2.8 | HPLC H2O | 10 | 72.5 |
7.5 | Total Volume | 10 | 130 |
Add 2.5 ul Indexed Primers and Track which goes with which
Bead Cleanup
Remove beads from cold room and let sit at RT for 30mins. Mix by inversion, light shaking before use.
Add 30 ul H2O and 40 ul Beads with Pipette Mix 10x using Integra pipette
Incubate RT 15 minutes
Incubate on magnet 5 minutes
Remove supernatant ~85 ul
Wash with 80% EtOH twice with 30s incubations
Remove any remaining EtOH
Resuspend in 21 ul H20 with mixing 10x
Incubate 5 minutes RT
Incubate 2 minutes on magnet
Transfer 20 ul to new wells (with MM on ice if proceeding)
TapeStation
qPCR
Pippin Prep?
Might need Pippin Size Selection