Samples:
| View file | ||
|---|---|---|
|
...
Test Samples: rhizosphere extractions
Temp Gradient Test to min. non specific amplification and max. product
Will just test pcr1 and check via bioanalyzer using higher cycling numbers (50 cycles instead of 20)
...
Transfer 40 ul to a clean PCR plate.
Test Full Prep with best Annealing Temp check via qPCR:
Add 11 ul Master mix to each well of a new plate:
...
ul/rxn | Reagent | # of rxns | ul needed |
|---|---|---|---|
3 | 5X Kapa HiFi Buffer | 25 | 75 |
0.45 | 10M dNTPs | 25 | 11.2 |
0.3 | Kapa HiFi HotStart DNA Pol | 25 | 7.5 |
0.5 ul | 10 uM F and R FlowCell Primers | 25 | 12.5 |
0.75 | HPLC H2O | 25 | 18.8 |
5 | Total Volume | 25 | 125 |
FlowCell Primers
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC
CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGG
...
Transfer 40 ul to a clean PCR plate.
Check molar concentration via qPCR:
Dilute Samples 1:1000
Include NTC and Standards (20 pm, 2 pm, 0.2, 0.02pm, 0.002pm, 0.0002pm)
...