Samples:
Paper detailing target and base primers
Fwd Primer Base (WANDA): CAGCCGCGGTAATTCCAGCT
Fwd Primer Base (AMV4.5NF): AAGCTCGTAGTTGAATTTCG
Rev Primer Base (AMDGR): CCCAACTATCCCTATTAATCA
200 sample multiplex required. Sticking to full columns for ease of handling, we will need 24 forward and 24 reverse primers for 576 possible combinations.
Design and sequences of 2-step sequencing primers.
Test Samples: rhizosphere extractions
Temp Gradient Test to min. non specific amplification and max. product
Will just test pcr1 and check via bioanalyzer using higher cycling numbers (50 cycles instead of 20)
Normalize eDNA to 10 ng/ul.
Add 11 ul Master mix to each well of a new plate:
Reagent | ul/rxn | rxns | ul needed |
---|---|---|---|
5X KAPA HiFi HotStart PCR Buffer | 3 | 45 | 135 |
10M dNTPs | 0.45 | 45 | 20.3 |
Kapa HiFi HotStart DNA Pol | 0.3 | 45 | 13.5 |
HPLC H2O | 7.25 | 45 | 326.2 |
Total Volume | 11 | 45 | 495 |
Add 2 ul appropriate 1 uM paired primers Molecular IDentifier (MID) Plate:______________
Use same template across all wells except row A. Add 2 ul template or TE for Blank:
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
A | Blank | Blank | Blank | Blank |
|
|
|
|
|
|
|
|
B | 64.4C | 64.4C | 64.4C | 64.4C |
|
|
|
|
|
|
|
|
C | 63.2C | 63.2C | 63.2C | 63.2C |
|
|
|
|
|
|
|
|
D | 61C | 61C | 61C | 61C |
|
|
|
|
|
|
|
|
E | 58.3C | 58.3C | 58.3C | 58.3C |
|
|
|
|
|
|
|
|
F | 56.2C | 56.2C | 56.2C | 56.2C |
|
|
|
|
|
|
|
|
G | 54.7C | 54.7C | 54.7C | 54.7C |
|
|
|
|
|
|
|
|
H | 54C | 54C | 54C | 54C |
|
|
|
|
|
|
|
|
Seal with bubble seals, spin, and run on thermocycler
Run on Thermocycler Program Am18S1Gr:
Temp C | Cycles | Time |
---|---|---|
95 | 1X | 3:00 |
95 | 50X | 1:00 |
54-65 (Gradient) | 50X | 1:00 |
72 | 50X | 1:00 |
72 | 1X | 10:00 |
4 | 1X | 0:00 |
Pool duplicates together.
Purify samples using modified manual AxyPrep MagBead PCR Clean-Up :
Equilibrate Beads to room Temperature
Pool Duplicate PCR reactions (Transfer 15 ul of one replicate to the other)
Add 24 ul of MagBeads to each well; Pipette mix up and down 10 times.
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 40 ul TE; pipette mix 10+ times. Incubate 2 minutes at RT.
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Transfer 40 ul to a clean PCR plate.
Test Full Prep with best Annealing Temp check via qPCR:
Add 11 ul Master mix to each well of a new plate:
Reagent | ul/rxn | rxns | ul needed |
---|---|---|---|
5X KAPA HiFi HotStart PCR Buffer | 3 | 45 | 135 |
10M dNTPs | 0.45 | 45 | 20.3 |
Kapa HiFi HotStart DNA Pol | 0.3 | 45 | 13.5 |
HPLC H2O | 7.25 | 45 | 326.2 |
Total Volume | 11 | 45 | 495 |
Add 2 ul appropriate 1 uM paired primers Molecular IDentifier (MID) Plate:______________
Use same template across all wells except row A. Add 2 ul template or TE for Blank:
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 |
A | Blank | Blank | Blank | Blank |
|
|
|
|
|
|
|
|
B | Template | Template | Template | Template |
|
|
|
|
|
|
|
|
C | Template | Template | Template | Template |
|
|
|
|
|
|
|
|
D | Template | Template | Template | Template |
|
|
|
|
|
|
|
|
E | Template | Template | Template | Template |
|
|
|
|
|
|
|
|
F | Template | Template | Template | Template |
|
|
|
|
|
|
|
|
G | Template | Template | Template | Template |
|
|
|
|
|
|
|
|
H | Template | Template | Template | Template |
|
|
|
|
|
|
|
|
Seal with bubble seals, spin, and run on thermocycler
Run on Thermocycler Program Am18S1Gr:
Temp C | Cycles | Time |
---|---|---|
95 | 1X | 3:00 |
95 | 20X | 1:00 |
54?? | 20X | 1:00 |
72 | 20X | 1:00 |
72 | 1X | 10:00 |
4 | 1X | 0:00 |
Pool duplicates together.
Purify samples using modified manual AxyPrep MagBead PCR Clean-Up :
Equilibrate Beads to room Temperature
Pool Duplicate PCR reactions (Transfer 15 ul of one replicate to the other)
Add 24 ul of MagBeads to each well; Pipette mix up and down 10 times.
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 40 ul TE; pipette mix 10+ times. Incubate 2 minutes at RT.
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Prepare next MasterMix while sample plate is on the magnet plate.
Add 5 ul FlowCell MasterMix to new plate:
ul/rxn | Reagent | # of rxns | ul needed |
---|---|---|---|
3 | 5X Kapa HiFi Buffer | 25 | 75 |
0.45 | 10M dNTPs | 25 | 11.2 |
0.3 | Kapa HiFi HotStart DNA Pol | 25 | 7.5 |
0.5 ul | 10 uM F and R FlowCell Primers | 25 | 12.5 |
0.75 | HPLC H2O | 25 | 18.8 |
5 | Total Volume | 25 | 125 |
FlowCell Primers
AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC
CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGG
Transfer 10 ul from plate on magnet plate to new plate.
Run on Thermocycler Program Am18S2:
Temp C | Cycles | Time |
---|---|---|
95* | 1X | 3:00* |
95 | 20X | 0:30 |
55 | 20X | 1:00 |
72 | 20X | 1:30 |
72 | 1X | 5:00 |
4 | 1X | 0:00 |
Equilibrate Beads to room Temperature
Add 15 ul H2O to each sample
Add 24 ul (0.8 x 30 ul) of MagBeads to each well; Pipette mix up and down 10 times
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well.
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 40 ul TE; pipette mix 10 times
Incubate at RT for 2 minutes
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Transfer 40 ul to a clean PCR plate.
Check molar concentration via qPCR:
Dilute Samples 1:1000
Include NTC and Standards (20 pm, 2 pm, 0.2, 0.02pm, 0.002pm, 0.0002pm)
ul/rxn | Reagent |
---|---|
10 ul | KAPA SYBR FAST qPCR MM (2X) |
2 ul | Primer Premix (10X) |
4 ul | Ultra Pure Water |
16 ul | Total Volume |
qPCR
Temp C | Cycles | Time |
---|---|---|
94 | 1X | 0:01 |
95 | 1X | 5:00 |
95 | 32X | 0:30 |
60 | 1:00 |