Page Comparison

...

GTGCCAGCAGCCGCGGTAAGCCACAGATACGTACCGCTCATAACGCGAACCGAAGCGCAGTAGAAGTACTCCGTATCCTACCTCGGTCGTGGTTTAGGCTATCGACATCTTGCATGGGCTTCCCTAGTGAACTCTTGGGATGTATTAGATACCCTAGTAGTCC

https://microcollaborative.atlassian.net/browse/

Tourlousse, D. M., Yoshiike, S., Ohashi, A., Matsukura, S., Noda, N., & Sekiguchi, Y. (2017). Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing

...

• 5'-FULL_ILLUMINA_FLOWCELL_SEQbarcodeGTGYCAGCMGCCGCGGTAA-3'

• 5'-FULL_ILLUMINA_FLOWCELL_SEQbarcodeGGACTACHVGGGTWTCTAAT-3'

• 5'-FULL_ILLUMINA_FLOWCELL_SEQbarcodeCTTGGTCATTTAGAGGAAGTAA-3'

• 5'-FULL_ILLUMINA_FLOWCELL_SEQbarcodeGCTGCGTTCTTCATCGATGC-3'

Actual Sequences: Information on oligos https://microcollaborative.atlassian.net/wiki/pages/createpage.action?spaceKey=MICLAB&title=Information%20on%20oligos&linkCreation=true&fromPageId=1357709336

Each 515F/806R and ITS1F/ITS2 were arrayed to create all 9216 possible MID pairings. The first MID array was a stamp of both plates (A1 in A1 for both plates) and was labeled 16S0A1 or ITS0A1. The second plate was a stamp of the reverse plate but the forward plate was rotated so that B1 went in A1, C1 in B1, D1 in C1, . . . , H12 in G12 and A1 in H12. This second plate was labeled 16S0B1 or ITS0B1 referring to the original position of the forward oligo plate MID that was located in A1 of the arrayed plate. This schema was continued around until 16S0H12 and ITS0H12 for 96 total MID plates for each locus.

Add 2 ul of modified eDNA aliquot to each well

...