Background Info
Primer bases:
LCO1490F (forward): GGTCAACAAATCATAAAGATATTGG
COI-CFMRa (reverse): GGWACTAATCAATTTCCAAATCC
Quantify DNA via absorbance and normalize to 10 ng/ul.
MasterMix
ul/rxn | Reagent | # of rxns | ul needed |
|---|---|---|---|
3 | 5X Kapa HiFi Buffer | 500 | 1500 |
0.45 | 10M dNTPs | 500 | 225 |
0.3 | Kapa HiFi HotStart DNA Pol | 500 | 150 |
5.25 | HPLC H2O | 500 | 2625 |
9 | Total Volume | 500 | 4500 |
Add 9 ul to each well of a hard shell, full skirt plate. Seal with bubble strips and store in refrigerator until needed label “NS5 PCR”. (If doing manually, one needs 4 2 ul of template and 2 ul of the primers).
Run CO1Lark plates on thermocycler program CO1Lark:
Step | Temp C | Cycles | Time |
|---|---|---|---|
Denature | 95 | 1X | 10:00 |
Denature | 94 | 35X | 1:00 |
Annealing** (Row C) | 50 | 35X | 1:30 |
Extension/Elongation | 72 | 35X | 1:00 |
Final Extension | 72 | 1X | 10:00 |
Hold | 4 | 1X | 0:00 |
Plate | CO1_LARK |
|---|---|
1BALD1 | CO1LARK1 |
CO1LARK2 | |
1BALD2 | CO1LARK3 |
CO1LARK4 | |
1BALD3 | CO1LARK5 |
...
Equilibrate Beads to room Temperature
Add 15uL of ultra pure water to each well.
Add 24 ul of MagBeads to each well.
Pipette mix up and down 10 times.
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 40 ul TE; pipette mix 10+ times. Incubate 2 minutes at RT.
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Transfer 40 ul to labeled transparent plate (Plate name_PCR_MIDs)
Pooling and Sequencing
Measure concentration of cleaned PCR via absorbance. Normalize to 5 ng/ul.
Use AssistPlus to pool all normalized PCR plates by column. Manually combine the single column. Run on Tapestation and qPCR.
...
Pool 2 parts TRNL with 2 parts fullITS and 1 part Baldwin CO1-Lark.
TRNL starting 2.77
FI starting 1.62
BALD starting 3.23
1 nM 1TYM_TRNL: 36 ul pool with 64 ul RSB
1 nM 1TYM_FI: 62 ul pool with 38 ul RSB
1 nM 1BALD_CO1: 31 ul pool with 69 ul RSB
Load Pool:
18 ul 1nM 1Bald
36 ul 1nM 1TYM_FI
36 ul 1nM 1TYM_TRNL
9 ul 1 nM PhiX
1 ul RSB