1BALD

Background Info

Primer Source Paper

Primer bases:

LCO1490F (forward): GGTCAACAAATCATAAAGATATTGG

COI-CFMRa (reverse): GGWACTAATCAATTTCCAAATCC

Quantify DNA via absorbance and normalize to 10 ng/ul.

MasterMix

• Add 9 ul to each well of a hard shell, full skirt plate. Seal with bubble strips and store in refrigerator until needed. (If doing manually, one needs 2 ul of template and 2 ul of the primers).

Run CO1Lark plates on thermocycler program CO1Lark:

Pool duplicates together.

MagBead Cleanup:

• Equilibrate Beads to room Temperature

• Add 15uL of ultra pure water to each well.

• Add 24 ul of MagBeads to each well.

• Pipette mix up and down 10 times.

• Incubate at RT for 5 minutes

• Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)

• Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.

• Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well

• Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well

• Reaspirate from each well to assure maximum EtOH removal

• Allow plate to air dry for 7 minutes.

• Remove sample plate from magnet plate.

• Add 40 ul TE; pipette mix 10+ times. Incubate 2 minutes at RT.

• Place sample plate back on magnet for 5 minutes or until all wells are cleared.

• Transfer 40 ul to labeled transparent plate (Plate name_PCR_MIDs)

Pooling and Sequencing

Measure concentration of cleaned PCR via absorbance. Normalize to 5 ng/ul.

Use AssistPlus to pool all normalized PCR plates by column. Manually combine the single column. Run on Tapestation and qPCR.

Open

Pool 2 parts TRNL with 2 parts fullITS and 1 part Baldwin CO1-Lark.

TRNL starting 2.77

FI starting 1.62

BALD starting 3.23

1 nM 1TYM_TRNL: 36 ul pool with 64 ul RSB

1 nM 1TYM_FI: 62 ul pool with 38 ul RSB

1 nM 1BALD_CO1: 31 ul pool with 69 ul RSB

Load Pool:

Bioinformatics