This experiment is to verify these CO1 primers can be sequenced. Primer Source Paper
Primer bases:
LCO1490F (forward): GGTCAACAAATCATAAAGATATTGG
COI-CFMRa (reverse): GGWACTAATCAATTTCCAAATCC
95 °C for 60 s, 45 °C for 90 s, 72 °C for 90 s; 28 cycles of: 94 °C for 60 s, 50 °C for 90 s, 72 °C for 60 s
PCR MasterMix
ul/rxn | Reagent | # of rxns | ul needed |
|---|---|---|---|
3 | 5X Kapa HiFi Buffer | 50 | 150 |
0.45 | 10M dNTPs | 50 | 22.5 |
0.3 | Kapa HiFi HotStart DNA Pol | 50 | 15 |
7.25 | HPLC H2O | 50 | 362.5 |
11 | Total Volume | 50 | 550 |
Add 11 ul to each well of a hard shell, full skirt plate. Add 2 uL of 0.5 uM primers and 2uL of template to each well.
Primers:
Run CO1Lark plates on thermocycler program CO1Lark:
Step | Temp C | Cycles | Time |
|---|---|---|---|
Denature | 95 | 1X | 10:00 |
Denature | 94 | 35X | 1:00 |
Annealing** (Row C) | 50 | 35X | 1:30 |
Extension/Elongation | 72 | 35X | 1:00 |
Final Extension | 72 | 1X | 10:00 |
Hold | 4 | 1X | 0:00 |
Run samples on TapeStation:
Positive Control Butterfly (D1):
Extraction Blank(A2):
Typical Amplification (42/D2):
Worst Amplification (43/E2):
Best Amplification (46/H2):