CO1Lark Sequencing Test

This experiment is to verify these CO1 primers can be sequenced. Primer Source Paper

Primer bases:

LCO1490F (forward): GGTCAACAAATCATAAAGATATTGG

COI-CFMRa (reverse): GGWACTAATCAATTTCCAAATCC

95 °C for 60 s, 45 °C for 90 s, 72 °C for 90 s; 28 cycles of: 94 °C for 60 s, 50 °C for 90 s, 72 °C for 60 s

PCR MasterMix

• Add 11 ul to each well of a hard shell, full skirt plate. Add 2 uL of 0.5 uM primers and 2uL of template to each well.

• Primers:

Run CO1Lark plates on thermocycler program CO1Lark:

Pool duplicates together.

MagBead Cleanup:

• Equilibrate Beads to room Temperature

• Add 15uL of ultra pure water to each well.

• Add 24 ul of MagBeads to each well.

• Pipette mix up and down 10 times.

• Incubate at RT for 5 minutes

• Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)

• Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.

• Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well

• Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well

• Reaspirate from each well to assure maximum EtOH removal

• Allow plate to air dry for 7 minutes.

• Remove sample plate from magnet plate.

• Add 40 ul TE; pipette mix 10+ times. Incubate 2 minutes at RT.

• Place sample plate back on magnet for 5 minutes or until all wells are cleared.

• Transfer 40 ul to labeled transparent plate (Plate name_PCR_MIDs)

qPCR

• Pool 2 ul of the TRNL and 16S samples separately. Make 1:1000 dilutions of each pool and run in triplicate.

• Make 1:1000 dilutions of columns 1,6, and 12 for each plate using 999 of TE and 1uL of sample into a deep well plate.

• Add 16 ul of Illumina Library Quantification MasterMix to each well:

• Add 4 ul of template, pool, or standards to each well:

Results:

The TRNL pool via standard size estimation returned a mean of ? nM. This should be adjusted for the difference between the standards' fragment sizes and the expected product size (452 vs 220). 9.41x(452/220) = 19.33 nM

16S is close enough to the standards' fragment size that the standard estimation can be used. 16S mean is 46.34 nM.

iSeq Sequencing:

Dilute TRNL Pool to 1 nM based off qPCR results. qPCR results are in pM, but 1:1000 dilution used. The results are effectively in nM for pool.

• 1000/Results = ul of Pool to Add

  • 1000/19.33 = 52uL of Pool to Add

• 1000 - ul of Pool to Add = ul of “10 mM Tris 8.5” to Add

  • 1000- 52 = 948 uL of 10mM Tris 8.5 to Add

Pool 16S Pool to 1 nM based off qPCR results. qPCR results are in pM, but 1:1000 dilution used. The results are effectively in nM for pool.

• 1000/Results = ul of Pool to Add

  • 1000/46.34 = 22 uL of Pool to Add

• 1000 - uL of Pool to Add = ul of “10 mM Tris 8.5” to Add

  • 1000- 22 = 978 uL of 10mM Tris 8.5

Combine 100 ul TRNL 1 nM pool to 100 ul 16S 1 nM pool to create a combined 1 nM pool

Dilute 1 nM full pool to loading concentration of 50 pM:

• Add 5 ul 1 nM Pool to 85 ul “10 mM Tris 8.5” and 10 ul 50 pM PhiX

• Remove iSeq 100 i1 Flow Cell from refrigerator 5’s crisper drawer and open white foil pack and allow to equilibrate to RT for 10-15 minutes.

• Open “iSeq 100 i1 Reagent Cartridge v2”. Turn on iSeq100

• Click on “Sequence”. Watch Video. Do what video tells you to do. Follow on screen instructions until run starts.