CO1Lark Sequencing Test

This experiment is to verify these CO1 primers can be sequenced. Primer Source Paper

Primer bases:

LCO1490F (forward): GGTCAACAAATCATAAAGATATTGG

COI-CFMRa (reverse): GGWACTAATCAATTTCCAAATCC

95 °C for 60 s, 45 °C for 90 s, 72 °C for 90 s; 28 cycles of: 94 °C for 60 s, 50 °C for 90 s, 72 °C for 60 s

PCR MasterMix

ul/rxn	Reagent	# of rxns	ul needed

ul/rxn	Reagent	# of rxns	ul needed
7.5	Kapa HiFi HotStart DNA 2X	120	900
4.5	HPLC H2O	120	540
12	Total Volume	384	1440

Add 11 ul to each well of a hard shell, full skirt plate. Add 2 uL of 0.5 uM primers and 2uL of template to each well.
Primers:

Run CO1Lark plates on thermocycler program CO1Lark:

Step	Temp C	Cycles	Time

Step	Temp C	Cycles	Time
Denature	95	1X	10:00
Denature	94	35X	1:00
Annealing** (Row C)	50	35X	1:30
Extension/Elongation	72	35X	1:00
Final Extension	72	1X	10:00
Hold	4	1X	0:00

Pool duplicates together.

Equilibrate Beads to room Temperature
Add 15uL of ultra pure water to each well.
Add 24 ul of MagBeads to each well.
Pipette mix up and down 10 times.
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 40 ul TE; pipette mix 10+ times. Incubate 2 minutes at RT.
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Transfer 40 ul to labeled transparent plate (Plate name_PCR_MIDs)

Pool 2 ul of the TRNL and 16S samples separately. Make 1:1000 dilutions of each pool and run in triplicate.
Make 1:1000 dilutions of columns 1,6, and 12 for each plate using 999 of TE and 1uL of sample into a deep well plate.

	1	2	3	4	5	6	7	8	9	10	11	12

ul/rxn	Reagent	# of rxns	ul needed

ul/rxn	Reagent	# of rxns	ul needed
10 ul	KAPA SYBR FAST qPCR MM (2X)	110	1100
2 ul	Primer Premix (10X)	110	220
4 ul	Ultra Pure Water	110	440
16 ul	Total Volume	110	1760

	1	2	3	4	5	6	7	8	9	10	11	12