New 2-step Amplicon Prep
Primer Design
Locus specific primers (GTCTCGTGGGCTCGGlocusSequence and TCGTCGGCAGCGTClocusSequence) are designed with the first portion of the Illumina adapter and the nonspecific second primer pairs are designed with the full adapters and indexes (CAAGCAGAAGACGGCATACGAGATindexGTCTCGTGGGCTCGG and AATGATACGGCGACCACCGAGATCTACACindexTCGTCGGCAGCGTC). Create 3 versions of each locus primer to stagger start. Add A or AG between Illumina adapter and locusSequence.
Locus Primer Prep
Dilute lyophilized primers to 100 uM strokes
Dilute working stocks to 1 uM: 10 ul primer, with 990 ul TE
Create Patterned Working Stock Plate by adding 60 ul of each:
Column 1 | Column 2 |
Org, AG | AG, Org |
A, A | Org, AG |
AG, Org | A, A |
Org, AG | AG, Org |
A, A | Org, AG |
AG, Org | A, A |
Org, AG | AG, Org |
A, A | Org, AG |
Patterning will accomplish the sequence staggering to lower the need for PhiX, should allow some measure of well to well contamination tracking, and allow us to provide a difference between replicates by alternating the starting column.
PCR2 Primer Prep
Dilute lyopholized primers to 100 uM stocks with TE
Add 10 ul of each to 990 ul TE to create 1 uM working stocks.
Add 500
PCR1
Make PCR1 MM:
ul/rxn | Reagent | Rxns | ul Needed |
|---|---|---|---|
2 | 5X KAPA HiFi HotStart PCR Buffer |
|
|
0.3 | 10M dNTPs |
|
|
0.2 | Kapa HiFi HotStart DNA Pol |
|
|
3.5 | HPLC H2O |
|
|
6 | Total Volume |
|
|
Add 6 ul MM to each well of each plate
Add 2 ul locus specific primers from plate alternating starting column
Add 2 ul normalized DNA
Run on thermocycler:
Temp | Time | Cycles |
|---|---|---|
95 | 2:00 | 1 |
95 | 2:00 |
20X |
? | 1:00 | |
72 | 1:00 | |
72 | 10:00 | 1 |
4 | 0:00 | 1 |
Dilute 15x by moving 2ul from each duplicate into 56 ul H2O
Tapestation a few original samples?
PCR2
Make PCR2 MM:
ul/rxn | Reagent | Rxns | ul Needed |
|---|---|---|---|
3 | 5X KAPA HiFi HotStart PCR Buffer |
|
|
0.45 | 10M dNTPs |
|
|
0.3 | Kapa HiFi HotStart DNA Pol |
|
|
8.25 | HPLC H2O |
|
|
12 | Total Volume |
|
|
Add 12 ul MM to each well
Add 2 ul primers and 1 ul from PCR1 dilutions
Temp | Time | Cycles |
|---|---|---|
95 | 1:00 | 1 |
95 | 0:30 |
15X |
63 | 0:30 | |
72 | 1:00 | |
72 | 5:00 | 1 |
4 | 0:00 | 1 |
Magbead Cleanup
Equilibrate Beads to room Temperature
Pool Duplicate PCR reactions (Transfer 10 ul of one replicate to the other)
Add 24 ul of MagBeads to each well; Pipette mix up and down 10 times.
Incubate at RT for 5 minutes
Secure plate on magnet plate; incubate at RT for 5 minutes (until wells are clear)
Remove 65 ul from each well; keep tips to left or right depending on the column to avoid bead pellet.
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Add 100 ul Fresh 80% EtOH to each well. Incubate 30 seconds. Remove 100 ul from each well
Reaspirate from each well to assure maximum EtOH removal
Allow plate to air dry for 7 minutes.
Remove sample plate from magnet plate.
Add 40 ul TE; pipette mix 10+ times. Incubate 2 minutes at RT.
Place sample plate back on magnet for 5 minutes or until all wells are cleared.
Transfer 40 ul to new plate.
Quantify via absorbance resulting plate.
Use Nimbus to normalize to 10ng/ul or less.
Pool resulting products.