/
TRNL herbivorous diet study (TRNL1)

TRNL herbivorous diet study (TRNL1)

Data were transferred to the GTL on 12-02-2021. They were relayed to the clients on 12-07-2021

Pools were sent to UC Genomics Core, waiting for repair this week of sequencer. Received tape station QC on 11-16-2021 and the GTL and University of Colorado approved for sequencing.

 

Sample ID

PF Clusters

Yield (Mbases)

% PF Clusters

% >= Q30

Mean Quality Score

TRNL1_T_16S_Pool

503,270,296

262,707

78.84

90.31

35.21

TRNL1_T_16S_Pool

501,795,512

261,937

78.61

90.06

35.16

Review of Tape Station QC from the University of Colorado was used to okay sequencing there.

Initial report from LIMS was converted with this r-script to the format for our bioinformatics pipeline to this demux key.

Design Info

Paper specifying target primer sequence

Forward Base Primer Sequence (trnl g) : GGGCAATCCTGAGCCAA

Reverse Base Primer Sequence (trnl h) : CCATTGAGTCTCTGCACCTATC

~500 Fecal Samples

<700 plant samples

It is likely we will be dealing with fewer plant samples than 700. 32 forward and 32 reverse primers will provide 1024 possible combinations or 10.66 plates. 40 by 40 will complicate pairing programing since 96 is not divided evenly by 40.

Design and sequences of 1-step sequencing primers.

Eurofins Order Form

Possibly adding more amplicons for parasites. This paper gives us some possible loci to consider.

Primer Dilution and arraying to 0.75 uM each

Primers arrived 9-14-2021 as 90 ul of TE at 100 uM. Add 710 ul TE to reduce Stock Concentration to 11.25 uM. Add 130 ul TE to 24 hard shell PCR plates. Run TRNL_Primer_Prep_Fully_Adjustable to array primers.

Arraying started at 9-15-21 at 11:04AM and finished at 5PM.

Related content

TRNL Sequencing Test
TRNL Sequencing Test
Read with this
Genome Technologies Laboratory Home
Genome Technologies Laboratory Home
More like this
Test Samples - BioAnalyzer (TRNL & AMF)
Test Samples - BioAnalyzer (TRNL & AMF)
Read with this
TRNL Test Samples - Extraction
TRNL Test Samples - Extraction
Read with this
Samples and Assigned Analyses
Samples and Assigned Analyses
More like this