CO1Lark Sequencing

Primer bases:

LCO1490F (forward): GGTCAACAAATCATAAAGATATTGG

COI-CFMRa (reverse): GGWACTAATCAATTTCCAAATCC

95 °C for 60 s, 45 °C for 90 s, 72 °C for 90 s; 28 cycles of: 94 °C for 60 s, 50 °C for 90 s, 72 °C for 60 s

PCR MasterMix

ul/rxn	Reagent	# of rxns	ul needed

ul/rxn	Reagent	# of rxns	ul needed
3	5X Kapa HiFi Buffer	220	660
0.45	10M dNTPs	220	99
0.3	Kapa HiFi HotStart DNA Pol	220	66
7.25	HPLC H2O	220	1595
11	Total Volume	220	2420

Add 11 ul to each well of a hard shell, full skirt plate. Add 2 uL of 0.5 uM primers and 2uL of template to each well.
Primers:

Run CO1Lark plates on thermocycler program CO1Lark:

Step	Temp C	Cycles	Time

Step	Temp C	Cycles	Time
Denature	95	1X	10:00
Denature	94	35X	1:00
Annealing** (Row C)	50	35X	1:30
Extension/Elongation	72	35X	1:00
Final Extension	72	1X	10:00
Hold	4	1X	0:00

Positive Control Butterfly (D1):

Extraction Blank(A2):

Typical Amplification (42/D2):

Worst Amplification (43/E2):

Best Amplification (46/H2):