/
Arbuscular Mycorrhizas 18S sequencing (AMF1)
Arbuscular Mycorrhizas 18S sequencing (AMF1)
@Bo Stevens
Samples:
Design Info:
Paper detailing target and base primers
Fwd Primer Base (AMV4.5NF): AAGCTCGTAGTTGAATTTCG
Rev Primer Base (AMDGR): CCCAACTATCCCTATTAATCA
200 sample multiplex required. Sticking to full columns for ease of handling, we will need 24 forward and 24 reverse primers for 576 possible combinations.
Design and sequences of 2-step sequencing primers.
Test Samples: Randomly selected good concentration (10ng/ul) normalized actual samples
Primer Dilution and arraying:
Primers arrived 9-14-2021 as 90 ul of TE at 100 uM. Add 710 ul TE to reduce Stock Concentration to 11.25 uM. Add 130 ul TE to 24 hard shell PCR plates. Run AMF_Primer_Prep_Fully_Adjustable to array primers at 0.75 uM.
Arraying started at 9-15-21 at 10:04AM and finished at 10:56AM.
Related content
Alfalfa Project for Buerkle Lab
Alfalfa Project for Buerkle Lab
Read with this
CO1Lark Sequencing Test
CO1Lark Sequencing Test
More like this
American Woodcock GBS (1Smin) & PJD Buntings
American Woodcock GBS (1Smin) & PJD Buntings
Read with this
CO1Lark Sequencing
CO1Lark Sequencing
More like this
micro NovaSeq Run #5
micro NovaSeq Run #5
Read with this
Test Samples - BioAnalyzer (TRNL & AMF)
Test Samples - BioAnalyzer (TRNL & AMF)
More like this